Abstract
Sixty-two fungal isolates were screened for lignin peroxidase production. The most potent isolates for lignin peroxidase production were identified using the DNA sequence of the internal transcribed spacer (ITS) region of Phanerochaete chrysosporium and Pleurotus ostreatus. The pretreatment of rice straw with P. chrysosporium, Pl. ostreatus, or lignin peroxidase for use in the biopulping process was studied. Great variations in the loss of pulp yield and kappa number were recorded with different fungal and enzyme treatments. Pretreatment of rice straw with P. chrysosporium for 25 days resulted in a substantial decrease in pulp yield (by 9.1%) and kappa number (by 25.6%). Losses of pulp yield and kappa number were considerably lower with lignin peroxidase treatment (3.7 and 14.1%, respectively). However, the pretreatment of rice straw with the Pl. ostreatus isolate caused moderate pulp yield losses (5.8%) and preferential lignin degradation (kappa number losses of 34.6%). This indicated that the Pl. ostreatus isolate might be superior to both the isolate of P. chrysosporium and lignin peroxidase for use in the biopulping process or other processes in which preferential lignin degradation is desired.
Download PDF
Full Article
Selection of Fungal Isolates for Biopulping of Rice Straw
Said M. Badr El-Din,a,* Zeinab H. Kheiralla,b Saad M. Abdel Malek,a and Douaa H. Abdel Aziz a
Sixty-two fungal isolates were screened for lignin peroxidase production. The most potent isolates for lignin peroxidase production were identified using the DNA sequence of the internal transcribed spacer (ITS) region as Phanerochaete chrysosporium and Pleurotus ostreatus. The pretreatment of rice straw with P. chrysosporium, Pl. ostreatus, or lignin peroxidase for use in the biopulping process was studied. Great variations in the loss of pulp yield and kappa number were recorded with different fungal and enzyme treatments. Pretreatment of rice straw with P. chrysosporium for 25 days resulted in a substantial decrease in pulp yield (by 9.1%) and kappa number (by 25.6%). Losses of pulp yield and kappa number were considerably lower with lignin peroxidase treatment (3.7 and 14.1%, respectively). However, the pretreatment of rice straw with the Pl. ostreatus isolate caused moderate pulp yield losses (5.8%) and preferential lignin degradation (kappa number losses of 34.6%). This indicated that the Pl. ostreatus isolate might be superior to both the isolate of P. chrysosporium and lignin peroxidase for use in the biopulping process or other processes in which preferential lignin degradation is desired.
Keywords: Lignin peroxidase; Biopulping; Rice straw; Phanerochaete chrysosporium; Pleurotus ostreatus
Contact information: a: Agricultural Microbiology Department, National Research Center, Cairo, Egypt; b: Botany Department, Faculty of Women for Arts, Science and Education, Ain Shams University, Egypt; *Corresponding author: [email protected]
INTRODUCTION
Lignocellulosic material can be obtained from wood, grass, agricultural residues, forestry wastes, and municipal solid wastes. Several biological methods for lignocellulose recycling, based on the enzymology of cellulose, hemi-cellulose, and lignin degradation, have been suggested. Among them, composting and use as a raw material for the production of ethanol as an alternative combustible form seem to be the most economic-ally feasible. Moreover, the general use of alternative, environmentally friendly technologies that introduce lignocellulose enzymes at different stages of pulp and paper manufacture as a pretreatment to pulping (biopulping) and bleaching (biobleaching) have allowed considerable electrical power savings, improvements in paper strength, and a reduction of pollutants in the waste water from these industries (Akhtar et al. 1998; Shukla et al. 2004; Singh et al. 2010; Isroi et al. 2011; Garmaroody et al. 2011). In addition, pretreatment of agricultural wastes with ligninolytic fungi enables the use of the wastes as raw material for paper manufacturing.
Increase of demand for paper production and limited wood resources have directed researchers to look for appropriate additional resources of non-wood materials for pulp and paper manufacturing. Several kinds of non-wood lignocellulosic by-products of agricultural cultivation have been investigated, of which wheat, rice, and barley straw are the most prominent (Yaghoubi et al. 2008; Xu et al. 2013; Wulandari et al. 2013), particularly in the countries with deficient wood resource, such as China, India, and Egypt. In Egypt, huge amounts of rice straw are produced annually as fibrous by-product. The disposal of these by-products is becoming a major problem. The microbial pretreat-ment is a natural process; therefore, no adverse environmental consequences are foreseen.
Biological pretreatment employs microorganisms and their enzymatic machin-eries to break down lignin and alter lignocellulosic structures. Some of the most promising microorganisms for biological pretreatment are white-rot fungi that can mineralize lignin to CO2 and water in pure culture (Eriksson et al. 1990; Akhtar et al. 1998). Several white-rot fungi such as Phanerochaete chrysosporium, Ceriporiopsis subvermispora, Phlebia subserialis, and Pleurotus ostreatus are capable of efficiently metabolizing lignin in a variety of lignocellulosic materials (Eriksson et al. 1990; Martinez et al. 1994; Dorado et al. 1999; Yaghoubi et al. 2008). The fungi have been studied in connection with several ligninolytic enzymes, such as lignin peroxidases (LiP), manganese peroxidases (MnP), laccase (Lac), and versatile peroxidases (VP) (Rodrigues et al. 2008; Singh et al. 2010; Isroi et al. 2011).
White rot fungi and their enzymes (especially ligninases and xylanases) have been considered for wood chip treatment prior to pulping. Although ligninases attack the lignin content of wood, xylanases degrade hemicelluloses and make the pulp more permeable for the removal of residual lignin. Thus, the biopulping process removes not only lignin but also some of the wood extractives, thus reducing the pitch content and effluent toxicity (Ali and Sreekrishnan 2001).
Lignin degradation by white rot fungi is a complex secondary metabolic process mediated by the action of several extracellular enzymes, of which lignin peroxidases are the most important (Buswell and Odier 1987; Akhtar et al. 1998; Rodrigues et al. 2008; Isroi et al. 2011). Consequently, they and their extracellular ligninolytic enzymes have been considered for various applications in environmental biotechnology. The present work aims to isolate and select fungal strains with high lignin peroxidase contents to use as a pretreatment for pulping (biopulping) of rice straw.
MATERIALS AND METHODS
Rice Straw
Rice straw was obtained from Kom Hamada City, El-Behira Province, Egypt. It was 2.0 to 2.5 mm in length. The main composition of the rice straw was as follows: cellulose, 40%; hemicellulose, 19%; lignin, 25%; and ash, 16%. The components (cellulose, hemicellulose, and lignin) of rice straw were analyzed according to the procedures of Goering and Van Soest (1971). Ash content was determined by ignited a straw sample of 2 gram in muffle furnace at 550 oC to constant weight.
Microorganisms
In the present study, 62 local fungal strains were isolated from different rice straw compost samples in Egypt. The serial dilution plate method was used. The potato dextrose agar (PDA) medium was poured into sterile petri plates, then inoculated with 1.0 mL from each dilution. The plates were incubated at 30 oC for 4 days, and individual colonies were grown out on slants of PDA medium. The isolated fungi were purified three times by restreaking on the same medium. Pure cultures of fungi were maintained on agar slants of PDA at 4 oC. The isolated pure cultures were tested for enzyme activity.
Selection of the Potent Isolates for Lignin Peroxidase Production
Erlenmeyer flasks (250 mL capacity) containing 50 mL of sterile potato dextrose broth medium were autoclaved. Each flask was inoculated with 2 fungal discs (0.8 cm) of a 4-day old culture and incubated at 30 oC in rotary shakers at 100 rpm for 2, 3, 4, 5, and 6 days. The cultures were filtered using Whatman no.1 filter paper for the removal of fungal growth. The filtrate was used as the source of crude enzyme.
Lignin peroxidase Assays
Lignin peroxidase activity was measured by the veratryl alcohol method (Tien and Kirk 1988). The assay mixture contained in a final volume of 2.5 mL was as follows: 1.8 mL of the diluted supernatant, 0.1 mL of 50 mM veratryl alcohol, 0.5 mL of 0.5 M sodium tartrate buffer (pH 3.0), and 0.1 mL of 10 mM H2O2. Oxidation of the substrate at room temperature was monitored by an absorbance increase at 310 nm due to the formation of veratraldehyde (ε 310 = 9300 M-1 cm-1). One unit of enzyme activity was defined as the amount of enzyme needed to produce 1 µmol of veratraldehyde per minute.
Dry Biomass Measurement
Fungal biomass determination was conducted by filtration through preweighed Whatman no.1 filter paper, washing with distilled water, and then drying in an oven until two successive equal weights for the same sample were obtained. The biomass was calculated in terms of gram per liter of growth medium.
Extraction of Genomic DNA
Fungal mycelia were grown on potato dextrose agar (PDA), harvested using a spatula, transferred into 1.5-mL Eppendorf tubes, suspended in 1 mL of T10E1 buffer (10 mM Tris-HCl, 1 mM EDTA [pH 8.0]), and centrifuged at 13,000 rpm for 5 min. The pellet was resuspended in 200 µL of 50 mM NaOH, vortexed, and incubated at 95 °C for 10 min. The mixture was then neutralized with 200 µL of 0.1 mM Tris-HCl (pH 7.0) and centrifuged for 5 min at 13,000 rpm. The pellet was resuspended in 500 µL of sterile H2O and centrifuged at 13,000 rpm for 5 min. The supernatant was removed, followed by the addition of 200 µL of cracking buffer (2% Triton X-100, 1% sodium dodecyl sulfate, 100 mM NaCl, 20 mM Tris [pH 8.0], 10 mM EDTA [pH 8.0]). Extraction of genomic DNA was achieved by addition of glass beads to 3/4 of the liquid volume, followed by the addition of 200 µL of cold phenol-chloroform-isoamyl alcohol in a 25:24:1 ratio. The mixture was subjected to constant vortexing for 30 min. The sample was then centrifuged at 13,000 rpm for 5 min. The aqueous (top) layer was transferred to a new tube, and 1 mL of 100% ethanol was added for DNA precipitation. The sample was centrifuged at 13,000 rpm for 2 min. The supernatant was removed, and the pellet was resuspended in 400 µL of T10E1 buffer plus 30 mg of RNase A (Sigma, St. Louis, MO) for a 1-h water bath incubation at 35 °C. The reaction was stopped, and the DNA was precipitated with 10 µL of 3 M sodium acetate and 1,000 µL of cold 100% ethanol. The sample was centrifuged at 13,000 rpm for 2 min, the supernatant was removed, and the pellet was air-dried. The DNA pellet was resuspended in 50 µL of TE buffer and was used as the DNA template for amplification after 30 min or stored at -20 oC for future use (Turenne et al. 1999).
PCR Amplification
The primers used for universal fungal amplification were ITS4 (reverse primer [5′-tcc tcc gct tat tga tat gc-3′]) (White et al. 1990) and fluorescently labeled (5′ HEX) ITS86 (forward primer [5′ -gtg aat cat cga atc ttt gaa c-3′]) (Life Technologies, Burlington, Ontario, Canada). The 50-µL PCR reaction mixture contained 5 µL of DNA template; 5 µL of 25 mM MgCl2–10 x PCR buffer; 1.25 mM deoxynucleoside triphosphate; dATP, dGTP, dCTP, and an 8:1 ratio of dUTP to dTTP; 0.5 µL of 100 mM of each primer; 0.5 units of uracil DNA glycosylase (UDG); 2.5 units of Taq DNA polymerase; and 30 µL of sterile distilled H2O. The PCR was performed in a GeneAmp PCR system 9600 (Perkin-Elmer Applied Biosystems, Foster City, Calif.) with cycles of 37 °C for 10 min (UDG activation) and 94 °C for 10 min (UDG inactivation) and 30 cycles of 94, 55, and 72 °C for 1 min each; the mixture was then incubated at 72 °C for 10 min for a final extension (Turenne et al. 1999).
DNA Sequencing
The PCR reaction products were sequenced directly using a big Dye terminator reagent kit including Taq polymerase and the protocol recommended by the manufacture (Perkin-Elmer). The reactions were run on an ABI 310 automated DNA sequencer (Applied Biosystems Incorporation, California, USA).
Phylogenetic Analysis
The blast program (www.ncbi.nlm.gov/blast) was used to assess DNA similar-ities; multiple sequence alignment and molecular phylogeny were performed using BioEdit software (Hall 1999). The phylogenetic tree was displayed using the TreeView program (Page 1996).
Inoculum Preparation
In preparing the liquid inoculum of the selected fungal isolates, 1-L flasks containing 200 mL of the fermentation medium were inoculated with 10 plugs cut with a number-8-size cork pore from a potato dextrose agar plate containing 10-day-old fungal cultures. The flasks were then incubated at 30 oC for 10 days. Flasks containing the fungal biomass were decanted and washed with sterilized distilled water to remove excess medium from the fungal biomass. The fungal biomass was then placed in sterilized distilled water and blended in a Waring blender twice for 15 s, each time at high speed. Distilled water was then added to the suspension to a total volume 100 mL (stock). About 1.0 mL of fungal suspension stock produced 0.005% (dry weight basis) inoculum of each strain.
Partial Purification of Lignin Peroxidase
The culture fluid was centrifuged at 10,000 rpm for 5 min at 4 oC to remove fungal mycelium. (NH4)2SO4 was added to the supernatant to 85% saturation at 4 oC. The precipitated crude lignin peroxidase fraction was recovered by centrifugation (10,000 rpm, 10 min). The pellet was resuspended in deionized water and dialyzed several times against 20 mM succinate (pH 3.5) for 2 days at room temperature. The protein content and lignin peroxidase activity were determined in the enzyme fraction. Protein content was determined as described by Lowry et al. (1951) using bovine serum albumin as a standard.
Fungal Pretreatment of Rice Straw
Wide-neck jars (2 L) containing 100 g of rice straw (dry weight), with 2.0-2.5 in length, were autoclaved at 121 oC for 20 min. After cooling the bioreactors, 440 mL of sterile distilled water containing 25 mg of mycelium (dry weight) of Phanerochaete chrysosporium or Pleurotus ostreatus or 10 mL of partially-purified enzyme solution were introduced into each of the jars to bring the final moisture of rice straw to about 60% (wet weight basis) and weighed. Rice straw and fungal biomass were mixed and incubated at 30 oC for 5, 10, 15, 20, and 25 days. The moisture content was kept for each jar at 60% of water holding capacity (WHC) during the experimental period. Controls were prepared under the same conditions but without inoculation.
Soda Pulping
Alkaline pulping was carried out by soaking straw (25 g oven dry weight) in a 1% solution of sodium hydroxide solution at a 10:1 liquor to straw ratio at 45 oC for 10 min. The saturated mass was squeezed and cooked with an addition of 12% sodium hydroxide at a straw to liquor ratio of 1:6 and 0.1 g anthraquinone % oven-dry straw with maximum temperatures at 127 oC and cooking time up to 60 min (El-Ashmawy et al. 1984). The resulting pulp was washed over filter paper and dried, and the yield and kappa number were determined. Kappa number was determined using the method described by Tasman and Berzins (1957).
RESULTS
Screening for Lignin Peroxidase Production from Isolated Fungi
The results in Table 1 show that the different fungal isolates exhibited a great variation in the lignin peroxidase activity. Of 62 fungal isolates, 11 isolates had lignin peroxidase activity. The highest enzyme activities were recorded after 4 days of incubation. The enzyme activities of such isolates ranged from 0.465 to 7.440 U/mL after 4 days of incubation. The most potent isolates for lignin peroxidase production were isolates 21 and 43. The enzyme activities of these isolates ranged from 5.673 to 7.440 U/mL after 4 days of incubation. Thus, those isolates were selected for further study.
Table 1. Lignin Peroxidase Activities for Fungal Isolates (U/mL)
PCR and DNA Sequencing
PCR products of the ITS (internal transcribed spacer) region (ITS1 + 5.8S + ITS2) amplified with primers ITS1 and ITS4 were visualized as a single band in agarose gels. The DNA sequences of the ITS region for isolates 21 and 43 are represented in Figs. 1 and 2, respectively.
AAAATACGATACTGAACAGGTTGTAAGCTGGCCTCTCGGGGCATGTGCACGCCTGGCTCATCCACTCTTCAACCTCTGTGCACTTGTTGTAGGTCGGTAGAAGAGCGAGCATCCTCTGATGCTTTGCTTGGAAGCCTTCCTATGTTTTACTACAAACGCCTTCAGTTTAAGAATGTCTACCTGCGTACAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGGAGCATGCCTGTTTGAGTGTCATGGTATCCTCAACCTTCATAACTTTTTTGTTACCGAAGGCTTGGACTTGGAAGGTTGTGCTGGCTTCAAGTCAAGTCGGCTCCCCTTAAATGTATTAGCGGGGGGGGTAACGGAATCCCTTCGGGGGGAAAATTATCTGCCCCCGGGGTCCTGAAGAAACAAAAGCCTGGGGCTTTCTAACCGTCCTTCAGTTGGACAACTTACTTTGACATCTGGCCCCAAATCAGGGAGAACACCCCCTGAACTTAACCTT
Fig. 1. DNA sequences of ITS region of isolate 21
CTTTCAACCACGAGAGAACTTTTGATAGATCTGGTGAAGTCGTCTCTCCAGTCGTCAGACTTGGTTGCTGGGATTTAAACGTCTCGGTGTGACTACGCAGTCTATTTACTTACACACCCCAAATGTATGTCTACGAATGTCATTTAATGGGCCTTGTGCCTTTAAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTAATTGCAGAATTCAGTGGAATCATCGAATCTTTGAACGCACCTTGCGCCCCCTTGGTATTCCCGAGGGGCATGCCTGGTTTGAGTGTCATTAAAATTTCTCAAACGCCACTTT
Fig. 2. DNA sequences of ITS region of isolate 43
Phylogenetic Analysis
The sequence data of isolates 21 and 43 were then analyzed using the Blast program (www.ncbi.nlm.gov/blast) to assess the DNA similarities. Multiple sequence alignment and molecular phylogeny were performed using BioEdit software; the phylogenetic trees are displayed, using the TreeView program, in Figs. 3 and 4.
Fig. 3. The phylogenetic tree showing the relationship between isolate 21 and other known sequences using the neighbor-joining method
Fig. 4. The phylogenetic tree showing the relationship between isolate 43 and other known sequences using the neighbor-joining method
The obtained results revealed that the sequence of isolate 21 showed the highest similarity (95%) with Phanerochaete chrysosporium (P. chrysosporium), and the sequence of isolate 43 showed the highest similarity (96%) with Pleurotus ostreatus (Pl. ostreatus).
Fungal Pretreatment of Rice Straw
The results in Table 2 showed considerable variation in the pulp yield losses of rice straw with different fungal and enzyme treatments. In all treatments, the pulp yield of rice straw was decreased gradually as time increased, as compared to the control treatment. The pulp yield losses ranged from 3.7 to 9.1% as compared to the control after 25 days incubation time. The greatest loss in pulp yield of rice straw was recorded after 25 days with P. chrysosporium treatment. The lowest loss in pulp yield of rice straw was detected after 25 days with lignin peroxidase treatment. Treatment of rice straw with Pl. ostreatus caused moderate losses of pulp yield.
The increase in the percentages of ash content (Table 2) in the pulp yield paralleled the losses in total dry weight in all the treatments throughout the experimental period. However, the actual amount of ash in all treatments did not show any remarkable changes. The highest increase in ash content in pulp yield occurred with the P. chrysosporium treatment. The lowest increase of ash content was observed with lignin peroxidase treatment.
The results also showed great variations in the kappa number of pulp with different fungal and enzyme treatments. During the experimental period, the kappa number reduced gradually from that of the control with all treatments. The fungal strains P. chrysosporium and Pl. ostreatus reduced the kappa number of pulp from that of the control by 25.6 and 34.6%, respectively. Lignin peroxidase treatment reduced the kappa number from that of the control by 14.1%.
Therefore, the pretreatment of rice straw with the Pl. ostreatus isolate caused moderate pulp yield losses and preferential lignin degradation. This indicated that the isolate of Pl. ostreatusmight be superior to both the isolate of P. chrysosporium and lignin peroxidase enzyme for use in biopulping processes or other processes in which preferential lignin degradation is desired.
Table 2. Effect of Fungal and Lignin Peroxidase Pretreatment of Rice Straw on Pulp Yield, Ash Content, and Kappa Number
DISCUSSION
The decomposition of lignin in nature has been believed for a long time to occur by the action of wood-rot fungi, mostly the Basidiomycete class. These microorganisms simultaneously decompose lignin and wood polysaccharides. Lignin degradation by white rot fungi is a complex secondary metabolic process mediated by the action of several extracellular enzymes, of which lignin peroxidases are the most important. In the course of screening for the lignin peroxidase production from fungi, 11 isolates out of 62 fungal isolates had lignin peroxidase activity. The most potent isolates for lignin peroxidase production were isolates 21 and 43.
The DNA sequences of the internal transcribed spacer (ITS) region for isolates 21 and 43 were analyzed by the Blast program for identification of fungal isolates. The obtained results revealed that the sequence of isolate 21 showed the highest similarity (95%) with Phanerochaete chrysosporium, and the sequence of isolate 43 showed the highest similarity (96%) with Pleurotus ostreatus. Several screening studies to find suitable fungi for biopulping of wood or agricultural wastes have revealed that, under certain conditions, fungi preferentially degrade lignin over cellulose. Such lignin-selective fungi include P. chrysosporium, Ceriporiopsis subvermispora (Kirk and Farrell 1987; Eriksson et al. 1990; Taniguchi et al. 2005), Pycnoporuscinnabarinus (Ander and Eriksson 1977), Pl. ostreatus (Martínez et al. 1994; Yaghoubi et al. 2008), Pl. eryngii (Martínez et al. 1994; Dorado et al. 1999), Phlebia radiata (Ander and Eriksson 1977), Phlebia tremellosa (Eriksson et al. 1990), Phlebia subserialis (Akhtar et al. 1998), Phellinus pini (Eriksson et al. 1990), and Dichomitus squalens (Eriksson et al. 1990).
In recent years, it has been demonstrated that the pretreatment of wood and agricultural wastes with lignin-degrading fungi could be beneficial not only to the process of mechanical pulping (Akhtar et al. 1998; Scott et al. 2002; Singh and Chen 2008) but also in chemical pulping (Messner and Srebotnik 1994; Akhtar et al. 1998; Isroi et al. 2011). Reports on biochemical pulping indicate a reduction in kappa number at a given pulp yield (Oriaran et al. 1990; Blanchette et al. 1992; Mosai et al. 1999; Yaghoubi et al. 2008) as well as improvements in certain physicochemical properties of paper handsheets, such as brightness and strength properties (Akhtar et al. 1998; Shukla et al. 2004; Singh et al. 2010; Isroi et al. 2011; Garmaroody et al. 2011) and a reduction of pollutants in the waste water from these industries (Yadav et al. 2010).
In the present study, great variations in the loss of pulp yield and kappa number were recorded with different fungal and enzyme treatments. Pretreatment of rice straw with P. chrysosporium for 25 days resulted in a substantial decrease in pulp yield (by 9.1%) and kappa number (by 25.6%) from that of the control. Losses of pulp yield and kappa number (3.7 and 14.1% from that of the control, respectively) were considerably lower with lignin peroxidase treatment of rice straw as compared with other fungal pretreatments. Pulp yield and kappa number were reduced by 5.8 and 34.6% from that of the control, respectively, with pretreatment by Pl. ostreatus of rice straw for 25 days. Similarly, Scott et al. (1996) reported that biosulfite pulping with C. subvermispora SS-3 for 2 weeks reduced the kappa number of pine by 21%, whereas pretreatment of spruce with C. subvermispora CZ-3 for 2 weeks resulted in a 22% kappa number decrease from that of the control (Fischer et al. 1994). Mosai et al. (1999) found that pretreatment of eucalyptus wood chips with C. subvermispora SS-3 for 10 days resulted in a decrease in kappa number by 29% and increase in brightness by 12%. Yaghoubi et al. (2008) used C. subvermispora for biochemical pulping of agricultural residues, and the results were compared with chemical pulping. Biological treatment of rice, wheat, and barley straw samples resulted in a decrease of the kappa number by 34, 21, and 19%, respectively, as compared with control samples.
In the present study, pretreatment of rice straw with the Pl. ostreatus isolate caused moderate pulp yield losses and preferential lignin degradation. Similarly, Taniguchi et al. (2005) reported that Pl. ostreatus preferentially degraded lignin over polysaccharides in rice straw, while P. chrysosporium and C. subvermispora degraded both lignin and polysaccharides in the straw. This indicated that the isolate of Pl. ostreatus might be superior to both the isolate of P. chrysosporium and lignin peroxidase enzyme for use in biopulping processes or other processes in which preferential lignin degradation is desired.
CONCLUSIONS
Of 62 fungal isolates, the most potent isolates for lignin peroxidase production were identified as Phanerochaete chrysosporium and Pleurotus ostreatus. Great variations in the loss of pulp yield and kappa number were recorded with the pretreatment of rice straw with P. chrysosporium, Pl. ostreatus, or lignin peroxidase. The Pl. ostreatus isolate may be superior to both the isolate of P. chrysosporium and lignin peroxidase for use in the biopulping process or other processes in which preferential lignin degradation is desired.
REFERENCES CITED
Akhtar, M., Blanchette, R. A., Myers, G. C., and Kirk, T. K. (1998). “Overview of biochemical pulping research,” in: Environmentally Friendly Technologies for the Pulp and Paper Industry, R. Young and M. Akhtar (eds.), John Wiley, New York.
Ali, M., and Sreekrishnan, T. R. (2001). “Aquatic toxicity from pulp and paper mill effluents: A review,” Adv. Environ. Res. 5(2), 175-196.
Ander, P., and Eriksson, K. E. (1977). “Selective degradation of wood components by white-rot fungi,” Physiol. Plant. 41(4), 239-248.
Blanchette, R. A., Burnes, T. A., Eerdmans, M. M., and Akhtar, M. (1992). “Evaluating isolates of Phanerochaete chrysosporium and Ceriporiopsis subvermispora for use in biological pulping processes,” Holzforschung 46(2), 109-115.
Buswell, J. A., and Odier, E. (1987). “Lignin biodegradation,” CRC Critical Reviews in Biotechnology 6(1), 1-60.
Dorado, J., Almendros, G., Camarero, S., Martinez, A. T., Vares, T., and Hatakka, A. (1999). “Transformation of wheat straw in the course of solid-state fermentation by four ligninolytic basidiomycetes,” Enzyme Microbial Technol. 25(8), 605-612.
El-Ashmawy, A. E., El-Saied, H., and Ibrahim, A. A. (1984). “Alkaline pulping of bagasse with anthraquinone,” Holzforschung 38(5), 289-292.
Eriksson, K. E. L., Blanchette, R. A., and Ander, P. (1990). Microbial and Enzymatic Degradation of Wood and Wood Components, Springer-Verlag, Berlin.
Fischer, K., Akhtar, M., Blanchette, R. A., Burnes, T. A., Messner, K., and Kirk, T. K. (1994). “Reduction of resin content in wood chips during experimental biological pulping processes,” Holzforschung 48(4), 285-290.
Garmaroody, E. R., Resalati, H., Fadim, P., Hosseini, S. Z., Rahnama, K., Saraeeyan, A. R., and Mirshokraee, S. A. (2011). “The effects of fungi pre-treatment of poplar chips on the kraft fiber properties,” Bioresource Technology 102, 4165-4170.
Goering, H. K., and Van Soest, P. J. (1971). Forage Fiber Analysis, USDA-ARS Agriculture Handbook, Government Printing Office, Washington, DC.
Hall, T. A. (1999). “BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT,” Nucleic Acids Symposium Series 41, 95-98.
Isroi, Millati, R., Syamsiah, S., Niklasson, C., Cahyanto, M. N., Lundquist, K., and Taherzadeh, M. J. (2011). Biological pretreatment of lignocelluloses with white-rot fungi and its applications: A review. BioResources 6(4), 5224-5259.
Kirk, T. K., and Farrell, R. L. (1987). “Enzymatic ‘combustion’: The microbial degradation of lignin,” Annual Review of Microbiology 41(1), 465-501.
Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951). “Protein measurement with the folin phenol reagent,” J. Biol. Chem. 193(1), 265-275.
Martinez, A. T., Camarero, S., Guillen, F., Gutierrez, A., Munoz, C., Varela, E., Martinez, M. J., Barrasa, J. M., Ruel, K., and Pelayo, J. M. (1994). “Progress in biopulping of non-woody materials: Chemical, enzymatic and ultrastructural aspect of wheat straw delignification with ligninolytic fungi from the genus Pleurotus,” FEMS Microbiology Reviews 13(2/3), 265-274.
Messner, K., and Srebotnik, E. (1994). “Biopulping: An overview of developments in an environmentally safe paper-making technology,” FEMS Microbiology Reviews 13(2/3), 351-364.
Mosai, S., Wolfaardt, J. F., Prior, B. A., and Christov, L. P. (1999). “Evaluation of selected white-rot fungi for biosulfite pulping,” Bioresource Technology 68(1), 89-93.
Oriaran, T. P., Labosky, P., and Blankenhorn, P. R. (1990). “Kraft pulp paper making properties of Phanerochaete chrysosporium degraded aspen,” Tappi J. 73(7), 147-152.
Page, R. D. M. (1996). “Tree view: An application to display phylogenetic trees on personal computers,” CABIOS 12(4), 357-358.
Rodrigues, M. A. M., Pinto, P., Bezerra, R. M. F., Dias, A. A., and Guedes, C. V. M. (2008). “Effect of enzyme extracts isolated from white-rot fungi on chemical composition and in vitro digestibility of wheat straw,” Anim. Feed Sci. Technol. 141, 326-338.
Shukla, O. P., Rai, U. N., and Subramanian, S. V. (2004). “Biopulping and biobleaching: An energy and environment saving technology for Indian pulp and paper industry,” Enviro News Newsletter of ISEB India 10(2), 7-8.
Singh, D., and Chen, S. (2008). “The white-rot fungus Phanerochaete chrysosporium: Conditions for the production of lignin degrading enzymes,” Appl. Microbiol. Biotechnol. 81C, 399-417.
Singh, P., Sulaiman, O., Hashim, R, Rupani, P. F., and Peng, L. C. (2010). “Biopulping of lignocellulosic material using different fungal species: A review,” Rev. Environ. Sci. Biotechnol. 9, 141-151.
Scott, G. M., Akhtar, M., Lentz, M. J., Sykes, M., and Abubakr, S. (1996). “Biosulphite pulping using Ceriporiopsis subvermispora,” in: Biotechnology in the Pulp and Paper Industry, E. Srebotnik and K. Messner (eds.), Facultas-Universitats Verlag, Vienna.
Scott, G. M., Akhtar, M., Swaney, R. E., and Houtman, C. G. (2002). “Recent development in biopulping technology at Madison. WI,” In: Progress in Biotechnology, L. Viikari and R. Lantto (eds). Elsevier, 61-71.
Taniguchi, M., Suzuki, H., Watanaba, D., Sakai, K., Hoshino, K., and Tanaka, T. (2005). “Evaluation of pretreatment with Pleurotus ostreatus for enzymatic hydrolysis of rice straw,” Journal of Bioscience and Bioengineering 100(6), 637-643.
Tasman, J. E., and Berzins, V. (1957). “The permanganate consumption of pulp materials II: The kappa number,” Tappi J. 40(9), 695-699.
Tien, M., and Kirk, T. K. (1988). “Lignin peroxidase of Phanerochaete chrysosporium,” Methods in Enzymology 161, 238-249.
Turenne, C. Y., Sanche, S. E., Hoban, D. J., Karlowsky, J. A., and Kabani, A. M. (1999). “Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system,” Journal of Clinical Microbiology 37(6), 1846-1851.
White, T. J., T. D. Burns, S. B. Lee, and J. W. Taylor. 1990. “Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics,” in: M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (eds.), PCR Protocols, Academic Press, San Diego, Calif, pp. 315-322.
Wulandari, A. P., Triyana, T., and Andayaningsih, P. (2013). “Delignification of rice straw with ligninase from novel Penicillium sp. strain apw-tt2 for biopulping,” International Journal of Bioscience, Biochemistry and Bioinformatics 3(1), 43-46.
Xu, G., Wang, X., and Hu, J. (2013). “Biobleaching of wheat straw pulp using laccase and xylanase,” BioResources 8(3), 3181-3188.
Yadav, R. D., Chaudhry, S., and Dhiman, S. S. (2010). “Biopulping and its potential to reduce effluent loads from bleaching of hard wood kraft pulp,” BioResources 3(1), 159-171.
Yaghoubi, K., Pazouki, M., and Shojaosadati, S. A. (2008). “Variable optimization for biopulping of agricultural residues by Ceriporiopsis subvermispora,” Bioresource Technology 99(10), 4321-4328.
Article submitted: June 6, 2013; Peer review completed: July 18, 2013; Revised version received: August 5, 2013; Accepted: August 6, 2013; Published: August 9, 2013.